White Gold | I Can See Your Voice | Goldwell Elumen permanente farbintensive Haarfarbe verschiedene Nuancen - 200 ml

Vectors for Phage Display

Vectors for Phage Display

C H A P T E R Vectors for Phage Display Norris Armstrong, Nils B. Adey, Stephen J. McConneli, and Brian K. Kay A range of vectors are available for ...

1MB Sizes 0 Downloads 2 Views

C H A P T E R

Vectors for Phage Display Norris Armstrong, Nils B. Adey, Stephen J. McConneli, and Brian K. Kay

A range of vectors are available for exogenous expression on the surface of bacteriophage M13 virus particles. The display sites most commonly used are within genes III or VIII, although there have been attempts at cloning in genes VII and IX (Makowski, 1993). Viral vectors that accept and display fusions for genes III and VIII have been termed type 3 and 8 (Smith, 1993), and are shown in Fig. 1. Many short peptides and a variety of proteins have been displayed at the N-terminus of mature pill. pVIII, on the other hand, appears to tolerate only short inserts of five (I1' ichev et al., 1989) or six amino acid additional residues (Greenwood et al., 1991); this may be due to the close packed nature of the viral surface (Kishchenko et al., 1994). Additional information regarding viral morphogenesis, pill, and pVIII can be found in Chapter 1. Many investigators have observed that some sequences are not well displayed on the surface of M13 phage, due to defects in viral particle assembly, stability, and infectivity. While most of this biological intolerance is unclear, two compensating vector systems have been designed. In one system, phagemid vectors carry a copy of either gene III or VIII; these vectors have been termed type 3+3 or 8+8 (Smith, 1993; Fig. 1). When bacterial cells harboring these phagemids are infected with M 13 helper phage, which carry the full complement of capsid-encoding genes but are defective in replication, the secreted phage particles carry the phagemid genome and a mixture of wild-type and fusion pills or pVIIIs (Fig. 2). In another system, the Phage Display of Peptides and Proteins Copyright 9 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

35

36

FIGURE

Norris Armstrong et

I

al.

Comparison of different M13 phage-display vectors and viral particles. The black boxes and spheres correspond to the foreign genetic elements and their encoded peptides, respectively. The displayed peptides, proteins, or protein domains are fused to either proteins III or VIII. Each vector system is then classified as type 3 or 8 depending on whether the fusion is with proteins III or VIII, respectively. Type 3 and 8 viral vectors have single copies of the fusion gene, whereas types 33 and 88 have two copies. Types 3+3 and 8+8 are phagemid based; virus particles are only formed when cells carrying the phagemid genomes are infected with M 13 helper virus particles.

vectors are p h a g e but carry two copies of gene III or VIII; bacterial cells infected with these phage incorporate both wild-type and fusion copies of pIII or pVIII into the s a m e viral particles. G e o r g e S m i t h has n a m e d this s e c o n d class of v e c t o r s as " 3 3 " or "88," to d e s i g n a t e p h a g e g e n o m e s that carry both w i l d - t y p e and r e c o m b i nant copies of genes III or VIII, respectively (Smith, 1993).

Chapter 3 Vectors for Phage Display

37

i

FIGURE 2

Diagram of bacterial cells infected with type 3+3 (or 8+8) viral genomes and secretion of viral particles. Bacteria carrying the phagemid genome are infected with M13 helper viruses which supply the missing M13 viral proteins in t r a n s . The phagemid genome is packaged and secreted more efficiently than the helper genome which is defective in replication.

One major feature of the 3+3 vector system is that the displayed element is often monovalent. The concentration of displayed proteins or peptides is diluted by the wild-type copies contributed by the helper phage. Thus both helper and phagemid viral particles will have 0-5 copies of the pill fusion protein per particle. This can be advantageous when the pill fusions yield phage which are not stable or infectious. The reduced valency is also valuable in eliminating avidity, thus permitting discrimination between low- and high-affinity display elements (see below).

38

Norris Armstrong et

ai.

In the 8+8 vector system, the valency of the displayed element is between 0 and 2400, with an average of several hundred reported per viral particle. The viral particles have a mixture of both fusion and wild-type pVIII. The increased valency of pVIII display, as c o m p a r e d to pill, has advantages in experiments in which lowaffinity receptors are the target. In spite of this increase in valency, people also use the pVIII phagemid when they want a greater distance between display units. Since only some fraction of the 2400 pVIIIs will be fusion protein, the probability of two fusions being next to each other is thought to be less than in the pill display system. A variety of commonly used display vectors are tabulated below, with their name, site of expression, restriction site used, marker carried on the vector, and reference. Vector

Gene

Rest. Site(s)

Marker

Reference

fUSE5 fAFF1 fd-CAT1 m663 fdtetDOG 33 33 88 88 Phagemid pHEN1 pComb3 pComb8 pCANTAB 5E p8V5 hSurfZap

III III III III III III III VIII VIII III III III VIII III VIII III

BglI-S--Bgll BstXI-S-BstXI PstI-S--XhoI XhoI-S-XbaI ApaLI-S_-NotI

tetR tetR tetR

(Scott and Smith, 1990) (Cwirlaet al., 1990) (McCaffertyet al., 1990) (Fowlkeset al., 1992) (Hoogenboomet al., 1991) (Corey et al., 1993) (McConnell et al., 1994) G. Smith, Univ. Missouri (Haaparanta and Huse, 1995) (Basset al., 1990) (Hoogenboomet al., 1991) (Gram et al., 1992) (Gram et al., 1992) Pharmacia Affymax (Hogrefeet al., 1993)

lacZ +

tetR

SfiI-S--NotI

SfiI-S--NotI

ampR ampR

SfiI-S-NotI BstXI-S-BstXI NotI-S--SpeI

ampR ampR ampR

NOTE: S, stuffer fragment with internal restriction sites in some cases; hSurfZap is commercially available from Stratagene (Cat. No. 240211). pCANTAB 5E is part of a recombinant phage antibody system sold by Pharmacia (Cat. No. 27-9401)" the GenBank accession number for pCANTAB 5E is U 14321. Nucleotide and protein coding sequences are shown in Figs. 3 - 8 for M 13 and several vectors listed in the table above. Only the regions covering the site of insertion for display are shown.

PHAGEMID The putative positions of the signal peptidase cleavage site for several constructs are noted, although in most cases they have not been confirmed. There has been one report that protein domains are more accessible when linked to domain 2 of pIII. Human growth hormone was more accessible to two different m o n o c l o n a l antibodies when attached to a truncated form of pIII (aa 1 9 8 - 4 0 6 ) (Lowman e t al., 1991). Most antibody display experiments have utilized this truncated form of pIII for efficient display. However, replacement of domain I (aa 1-198) of pIII with an exogenous sequence leads to noninfectious phage; these par-

Chapter 3 Vectorsfor Phage Display

FIGURE 3

3

Map of M13mpl8 genome. Unique restriction sites are shown on the circular map of M13mpl8 (Accession No. X02513). The 10 viral genes are shown as boxes on the map; they are transcribed in a clockwise fashion. The polylinker within the lac Z gene contains the following restriction sites: EcoRI, SacI, KpnI, SmaI, XmaI, BamHI, SalI, HinclI, AccI, SphI, and HindlII. The origin of replication can be in either orientation to direct the replication and packaging of either the plus or minus strand. The figure was generated with the program MacPlasmap, written by Jingdong Liu (Salt Lake City, UT).

ticles must also carry wild-type plII, expressed from a second gene III in the vector (i.e., type 33) or a helper phage genome. In several vectors, the displayed element is separated from the remainder of pill or pVIII, by short linkers. While there have been no formal experiments on the best linker sequences to use, many vectors use some variation of the sequence GGGGS. There are two glycine-rich regions in pill (i.e., 68-86 and 218-256), consisting of many GGGS and EGGGS repeats. It is also possible to include a proteolytic cleavage site

40

Norris Armstrong et

FIGURE 4

Map of two M13 type 3 viral vectors. These vectors were derived from M13mp8 according to Fowlkes et al. (1992). The vectors carry cloning sites XhoI and XbaI, in gene III for expression of foreign sequences; these sites flank the c-myc epitope recognized by mAb 9El0. In addition, one vector (m663) carries a segment of the alpha fragment of [3-galactosidase; bacterial cells expressing the omega fragment of [3galactosidase convert the clear XGal substrate into an insoluble blue precipitate and the plaques appear blue. The other vector (m655) carries the tetracycline resistance gene of pBR322 at the polylinker site.

al.

,,,

,,

b e t w e e n the displayed peptide/protein and the capsid protein. A Factor Xa cleavage site, IEGR, has been engineered in the M 1 3 m p l 8 X a vector (Fig. 8; of Cytogen Corporation, Princeton, N. J.) which permits viral particles bound to any target to be rec o v e r e d by treatment with Factor Xa. The presence of a string of five glycines downstream of the Factor Xa cleavage site may enhance its cleavage efficiency (Rodriguez and Carrasco, 1994).

41

Chapter 3 Vectorsfor Phage Display

lacZ ~

T3

IRBS I

pelB leader

insert Xhol

FIGURE 5

Full-length mature pill Xbal

Map of a phagemid (type 3+3) vector. This vector was constructed by N. B. Adey, by cloning gene III from m663 into the lac Z gene of pBluescript. It expresses the full-length form of mature protein III with the pelB leader sequence. The gene is under the control of lac 0 and has a ribosome binding sequence (RBS).

To reduce the level of nonrecombinants in phage display libraries, the reading frames of genes III or VIII have been intentionally destroyed in the stuffer sequence of some vectors. This has been accomplished by frame-shifting (adding or deleting a nucleotide) the gene when it was engineered with restriction sites. Thus, the reading frames are restored in the vector when the stuffer fragments are replaced with DNA encoding peptides or protein domains which have the appropriate reading

42

Norris Armstrong et

al.

angiotensin II tag 9.

S TCT

H CAC

S TCC

A D IN GCT GAA AAC

R V CGT GTT

Y I TAC ATC

R CGG

P CCA

G GGT

G GGG

L R TTA AGC

G GGC

H P FI CAC CCG TTC

G GGT

G GGG

D GAT

aa 198

Sfi I

FIGURE 6

P A CCA GCA

R M CGC ATG

G TGG..

Not I

Map of a type 33 vector. This vector was constructed by Stephen McConnell and Ronald Hoess (DuPontMerck, Willmington, DE) and described in a publication (McConnell et al., 1994). It was derived from M13 and carries two copies of gene III [i.e., full-length and truncated (aa 198-408)]. Each copy of plII is epitope-tagged with a short segment of angiotensin II protein which is recognized by a mouse monoclonal antibody. Inset shows the results of a Western blot performed with this antibody protein; viral particles express both the full-length and the truncated forms of plII at a ratio of 5:1, respectively.

frames. As plII and pVIII are required components of the virus particle, this strategy permits positive selection of r e c o m b i n a n t versus parental genomes. One caveat of this selection scheme, however, is that reversion of the defective genes occurs frequently, leading to a loss of d i s c r i m i n a t i o n b e t w e e n r e c o m b i n a n t and parental genomes. Another means of selecting for recombinant versus parental phage is to include a stop codon in the stuffer fragments of genes III or VIII. The stop codon, TAG, can be s u p p r e s s e d efficiently in bacteria containing supE or supF; when these vectors are p r o p a g a t e d in such b a c t e r i a l strains e i t h e r a g l u t a m i n e (Q) or t y r o s i n e (Y) is inserted at the TAG codon, respectively. However, when TAG containing genes III or VIII are in bacterial strains that lack either supE or supF, no full-length pIII or pVIII accumulate and no virus particles are generated. This is a very powerful m e t h o d of selecting for recombinant phage. In our own hands, almost no (i.e., <10 -6 ) parental p h a g e exist in a library w h e n ligation mixes (double-cut vector and open reading flame fragments) are introduced into suppressor-less F' bacteria.

Chapter 3 Vectors for Phage Display

FIGURE 7

43

Maps and sequences of Stratagene's SurfZAP vector. Diagram of how inserts are cloned into k and excised as phagemid genomes. Maps were kindly provided by Dr. Holly Hofgrefe (Stratagene, La Jolla, CA). continues

One vector that deserves additional comment is kSurfZap. This vector takes advantage of the efficient cloning of DNA segments by in vitro packaging. In this system, inserts are cloned into a truncated gene III (aa 198-406) that resides in the excision portion of the h vector (Fig. 7A, B). Once a library of h recombinants has been generated, the phagemid genomes are excised by coinfecting cells with M13 helper phage; at the same time the secreted phage particles are displaying a mixture of wild-type and fusion pills. Thus, hSurfZap yields 3+3 viral particles.

B Left Arm of the SurtZAP TM Vector The 5" end of your insert must include a complete Not I site (include at least 15 extra nucleotides 5" of the Not I site for help in enzyme recognition). After the Not I site, the remainder of the pelB leader sequence must be included,

Vector

pelB Leader Sequence

RBS

Notl

5" AATTAAC~CTCACTAAAGGGAACAAAAGCTGGAGCTTGAATTCTTAA~TACTCGCCAAGGAGACAGTCATAATGAAATACCTATTGCCTACGGCGGCCGC Ib r

T3 Promoter

EcoR I

M

K

Y

L

L

P

T

A

A

z

O -1 r

> -'% 3

Example Insert Remaining pelB Leader Sequence

5" CTCGCTCGCCCATATGCGGCCGCAGGTCTCCTCCTCTTAGCAGCACAACCAGCAATGGCCXXXXXXNctl

A

G

L

L

L

L

A

A

Q

P

A

M

r t~ O 0~ r

3"

A

.-...

Right Arm of the SurfZAP TM Vector The 3" end of your insert (XXX) should be in-frame and should include the downstream Spe I restriction site. Be sure to include four to six additional nucleotides (e.g., GATGCF) on the 3" end to aid in efficient endonuclease digestion of the insert template.

Vector

Flexible linker Spel 5"

-

G

G

G

gill (198-406) G

S

ACTAGTGGAGGTGGAGGTAGCCCATTCGTTTGTGAATATCAGGGCCAATCGTCTGACCTGCCTCAACCTCCTGTCAATGCTGGCGGCGGCTCTGGTG 198

GTGGTTCTGGTGGCGGCTCTGAGGGTGGTGGCTCTGAGGGTGGCGGTTCTGAGGGTGGCGGCTCTGAGGGAGGCGGTTCCGGTGGTGGCTCTGGTTCCGG TGATTTTGATTATGAAAAGATGGCAAAcGCTAATAAGGGGGCTATGACCGAAAATGCCGATGAAAACGCGCTACAGTCTGACGCTAAAGGCAAACTTGAT TCTGTcGcTACTGATTAcGGTGCTGCTATCGATGGTTTCATTGGTGACGTTTCCGGCCTTGCTAATGGTAATGGTGCTACTGGTGATTTTGCTGGCTCTA ATTcCcAAATGGCTCAAGTCGGTGAcGGTGATAATTCACCTTTAATGAATAATTTCCGTCAATATTTACCTTCCCTCCCTCAATCGGTTGAATGTCGCCC TTTTGTCTTTGGCGcTGGTAAACCATATGAATTTTcTATTGATTGTGACAAAATAAACTTATTCCGTGGTGTCTTTGCGTTTCTTTTATATGTTGCCACC TTTATGTATGTATTTTCTACGTTTGCTAACATAcTGCGTAATAAGGAGTCTTAATCATGCCAGTTCAAAAGGGTATTCCATTATTCTAGAGTTAAGCGGC 406 stop

CGTCGAGGGGGGGCCCGGTACCCAATTCGCCCTAT~AGTGAGTCGTATTA T7 Promoter

FIGURE

7

Continued

3" untranslated

Xbal

45

Chapter 3 Vectors for Phage Display

Cloning Sites in M13 genes

signal

gene III

peptide

cleavage site fUSE5

-1 $ + 1 Y S H S A D G A no open frame in vector . .CTATTCTCACTCGGCCGACGTGGCCTGGCCTCTGGGCCGAAACTGTTGAA..

Sfi I

Sfi I

signal peptide cleavage site

fd-CAT1 L

H

-1 $+1 S A

Q

v

Q

L

Q

E

L

E

I

K

R

9 .T C T C A C T C C G C T C A G G T C C A A C T G C A G G A G C T C G A G A T C A A A C G G . .

Pst I

Xho I

signal peptide cleavage site fAFF1 -1 $ +1 P F Y W H S no open reading frame 9 CCATTCTACTGGCACTCCGCTGAAACTGTTCCAGTTGTCTGG..

BstX I

FIGURE 8

BstX I

Nucleotide and coding sequences surrounding cloning sites in genes III or VIII of various vectors. The names of the vectors are listed along with the nucleotide and coding sequences of each vector. continues

While most phage display vectors have been used to express single peptides or protein subunits, it is possible to express two heterodimeric protein subunits. In pComb3, there are two lac promoters followed by pelB leader sequences that can drive expression of different protein subunits, one of which is fused to plII and the other is secreted. In the periplasmic space of cells carrying pComb3, the pill fusion and the secreted protein have the opportunity to associate, prior to secretion of the virus particle. This vector, and other similar ones, has been used to display assembled immunoglobulin heavy and light chains (Barbas et al., 1991; Kang et al., 1991; Winter and Milstein, 1991).

MARKERS

In choosing a vector for display, genetic markers can be a consideration. These include antibiotic resistance, epitope expression, lacZ expression, and stop codons. Each of these various attributes is described below9

46

Norris Armstrong et al.

gene III

signal peptide cleavage site

fd-tet-DOG

-I ~ + i H S A Q v Q L Q E L E I K R A A A E T V 9 CACAGTGCACAGGTCCAACTGCAGGAGCTCGAGATCAAACGGGCGGCCGCAGAAACTGTT..

ApaL I

Pst I

Sac I

Xho I

Not I

signal peptide cleavage site I

m663

c-myc epitope,

-1 ; + 1 S

S

R

[E

Q

K

L

I

S

.. TCC T C G A G A G A G C A G A A A C T G A T C T C

E

m A b 9E10 E

D

L

NlS

Xho I

M13mp18Xa -1 s

R

P

s

R

T

TGAAGAAGACCT GAACTC TAGACCT TCGAGAACT..

Xba I

signal peptide cleavage site c-myc epitope,

+1 s

R

IE

*

K

~,

I

S

E

Factor Xa cleavage site

m A b 9E10 E

D

L

NIs

R II

E

G RIA

R

e

s

R

T

TCCT C G A G A G A G T A G A A A C T GATCT C T G A A G A A G A C C T G A A C TCTAG/X3kT C G A A G G T C G C GC T A G A C C T T C G A G A A C T . .

. .

Xho I

Xba I

M13 PL-6 V V P F * S H S A G .. G T G G T A C C T T T C T A G T C C C A C T C C G C T G G T G . .

Kpn I

FIGURE

Drug

8

BstX I

Continued

Resistance

In a number of vectors, there are drug resistance genes which have been introduced by bacterial transposons. Under tetracycline selection, the fd-tet vector can be grown in bacterial cells as a plasmid, independent of phage production. This permits the propagation of engineered M 13 genomes which normally would not yield viable phage (i.e., frameshifted in gene III) as plasmids inside bacteria. The fd-tet vector has served as the starting point for the construction of the fUSE vectors of G. Smith. These vectors not only carry the tetracycline resistance gene, but also have a very low (i.e., -1) intracellular RF copy number. Tetracycline selection minimizes the loss from a recombinant library of those phage that replicate slowly due to their inserts. The fd-tet vector can be made kanamycin resistant by replacing a NsiI fragment with a PstI fragment from the vector pUC-4K (Pharmacia, Cat. No. 27-4958) which encodes kanamycin resistance (Doorbar and Winter, 1994).

Chapter 3

47

Vectors for Phage Display

gene III signal peptide cleavage site

pHENI

-1 $ + 1 L L A A Q P A M A Q V Q L Q V D L E I K R 9 TTACTCGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGCAGGTCGACCTCGAGATCAAACGG

Sfi I

Nco I

,~ I

Sal I

Xho I

c-myc epitope, mAb 9E10 A A AlE O K L I S E E D L N] G A A * T V E 9 GCGGCCGCAGAACAAAAACTCATCTCAGAAGAGGATCTGAATGGGGCCGCATA___GACTGTTGAA..

Not /

kSurfZap

signal peptide cleavage site I

pelB leader sequence

-1 ~+1

+198

[M K Y L L P T A A A G L L L L A]Q P A M A L V G G G G S P .. A T G A A A T A C C T A T T G C C T A C G G C G G C C G C A G G T C T C C T C C T C T T A G C A G C A C A A G C A A T G G C • A C T A G T G G A G G T G G A G G T A G C C c A . .

Not I

Spe I

gene III

mBAX

signal peptide cleavage site -I ~ + i

S S[I D M P * T A S T M Y N M L H R N E P] .. T C C T C G A G T A T C G A C A T G C C T T A G A C T G C T A G C A C T A T G T A C A A C A T G C T T C A T C G C A A C G A G C C A

Xho I

...epitope, mAb... [.G G R K L S P P A N D M P P A L L K RIs R GGTGGGAGGAAGT TGAGCCCGCCCGCCAACGACATGCCGCCCGCCCTCCTGAAGAGGTCTAGA..

Xba I

FIGURE 8

Continued

Epitope

Several vectors have been engineered to express short peptide "tags" that can be recognized by particular monoclonal antibodies. One such sequence is the c-myc

48

Norris Armstrong et al.

gene VIII

pC89

signal peptide cleavage site -1 $ + 1 A V A T L V P M L S F A A E G E F * D P 9 .G C C G T T G C T A C C C T C G T T C C G A T G C T C T C T T T C G C T G C T G A G G G T G A A T T C T A G G A T C C C . .

EcoR I

BamH I

signal peptide cleavage site

f884

-1 $ + 1 A T L V P M L S F A N V A E G D D P 9 GCGCTTGTTCCTATGCTAAGCTTTGCCAACGTCCCTGCAGAAGTTGATGACCCG..

Hind III

psvs

Pst I

M K K N I A F L L A S M F V F S I . .A T G A A A A A G A A T A T C G C A T T T C T T C T T G C A T C T A T G T T C G T T T T T T C T A T T G C T

A

signal peptide cleavage site -1

r

T N A V V no o p e n r e a d i n g f r a m e ACCATTCTACTGGCACTCCGCTGAAACTGTTCCAGTTGTCTGG..

BstX I

FIGURE 8

BstX I

Continued

epitope, EQKLISEEDLN, which is recognized by mAb 9E10. In some vectors (m663, M13mp 18Xa) the c-myc epitope is in the stuffer fragment where it is useful in immunologically discriminating between parental and recombinant phage particles, for the purposes of estimating the percentage of recombinants in a library. In the pHEN vector (Hoogenboom et al., 1991), it is upstream of the cloning site in gene III; this arrangement is useful in detecting chimeric pIII molecules on Western blots and verifying that full-length chimeric molecules exist on phage. LacZ

The vectors m663 (Fowlkes et al., 1992) and M13mpl8Xa (Cytogen) carry lacZ genes. When these vectors are in the appropriate bacterial host (laclqZAM15) that has been exposed to the inducer isopropyl-[3-D-thiogalactopyranoside (IPTG), functional [3-galactosidase activity is present. Thus, this gene can be detected easily by

Chapter 3 Vectors for Phage Display

49

the occurrence of blue plaques in bacterial lawns containing the indicator bromo4-chloro-3-indoyl-[3-D-galactoside (XGal). Vectors with the lacZ gene permit simple discrimination between plaques formed by different phage genomes (i.e., original and evolved phage; see Chapter 14).

Stop Codons Suppressed stop codons have also been placed between displayed protein domains and domain II of pill. When such recombinants are propagated in a suppressor carrying bacterial strain, virus particles are produced incorporating chimeric protein domain pill into the capsids. After screening phage populations for virus particles with certain properties (based on the particular protein domain displayed), individual isolates can be introduced into bacteria strains that lack suppressors. In these hosts, there is efficient translational termination at the stop codon in the chimeric gene III, and consequently the protein domain is secreted by itself. This has been a very effective means of generating soluble forms of the protein, such as antibodies (Hoogenboom et al., 1991) or growth hormone (Lowman and Wells, 1993), for testing purposes.

OTHER VIRAL DISPLAY VECTORS Recently, another viral display system has been described based on bacteriophage h. The entire [3-galactosidase protein has been expressed at the C-terminus of protein V with full enzymatic activity and without loss of phage infectivity (Maruyama et al., 1994). There have also been reports that exogenous segments can be displayed as fusions with proteins J (Waclaw Szybalski, University of Wisconsin, Madison, WI) and D (Sternberg and Hoess, 1995) of h. Bacteriophage h may be a useful vector for the display of cDNA segments, and because large recombinant libraries can be generated in this vector with commercially available in vitro packaging systems. Other viruses remain to be exploited, such as RNA phage Q[3 (Kozlovska et al., 1993), baculovirus, and retroviruses. There have been two reports of expressing erythropoietin (Kasahara et al., 1994) or RGD peptides (Valsesia-Wittmann et al., 1994) on the surface of retroviruses for the purposes of improving or redirecting viral uptake by animal cells.

PROTEOLYSIS An important issue to keep in mind is that the displayed peptide or protein domain is susceptible to proteolysis. While M 13 phage are resistant to many proteases (i.e., trypsin, chymotrypsin) (Schwind et al., 1992), the displayed peptides and protein domains are not. Stocks of recombinant phage can lose their displayed element in hours to days when stored at 4~ in culture supernatant. Proteolysis can be minimized by

50

Norris Armstrong et

al.

storing phage supernatants with 20% glycerol at -80~ polyethylene glycol precipitation, or CsC1 banding. For short-term experiments monitoring binding properties of particular phage isolates, it is important to work with fresh (i.e., 6-18 hr) culture supernatants whenever possible. It is likely that the addition of protease inhibitors would lengthen the storage life of the displayed protein or peptide of phage kept in the refrigerator. However, in the long run, phage stocks should be maintained as phage in 20% glycerol at-80~ or as DNA in the-20~ freezer.

VALENCY The display of peptides or proteins in M 13 can have a valency of one to thousands of copies. This is dependent on the display site and type of vector. There are a number of important considerations in choosing display systems. The type of fusion, expression levels, and experiment will dictate which display system is appropriate. Multivalent display

Monovalent display

pIII or pVIII phage

Type 3+3 and 8+8 phagemids, type 33 and 88 phage The negative effect of the displayed element is minimized Discrimination between modest and high-affinity binders Many particles are displaying 0-1 copies (i.e., pIII fusions) or 0-2400 copies (i.e., pVIII) of the fusion protein

Displayed element might affect phage infectivity Isolation of modest affinity binders Virus particles display the sequence in 3-5 (i.e., plII fusion) 2400 copies (i.e., pVIII fusion)

The phagemid and 33 vector systems have proven to be useful in discriminating between peptides or proteins of moderate versus high binding affinity. McConnell et al. (1994) have demonstrated that a collection of phage, displaying peptides that bind to a monoclonal antibody, can bind equivalently, even though corresponding synthetic peptides differ as much as 20-fold in relative affinity by radioimmunoassay. However, when the same peptide is displayed by a 33 vector, the relative binding of the phage correlates well with the synthetic peptide results. When McConnell measured the valency of the fusions displayed on the "33" viral particles, there was an average of 0.74 chimeric proteins per phage particle. These experiments suggest that monovalent phage display can be used to discriminate between modest and high affinity binding peptides. In summary, monovalent display can be a useful tool for the display of peptides and proteins that may not be well tolerated by M 13 in 5 or 2800 copies. Monovalent display also allows the discrimination of displayed molecules that bind targets with moderate versus high affinity. The use of polyvalent display vectors should not be precluded, however, since in the initial stages of selection of binding peptides it is often more important to accumulate a broad spectrum of peptides as potential leads than to identify a single high-affinity lead. The peptides identified can then be ordered in terms of their affinities using monovalent display or other methods.

Chapter 3 Vectors for Phage Display

5I

ISSUE OF B I O L O G I C A L S E L E C T I O N A number of investigators have characterized their random peptide libraries by observing the frequency of amino acids at each random position and the frequency of all possible dipeptide frequencies. It appears that most, if not all, possible dipeptide combinations can be found in phage display libraries (Cwirla et al., 1990; DeGraaf et al., 1993). During our analysis of random peptides expressed by M13 within pIII, we have observed that there is a strong negative selection against odd numbers of cysteine residues (Kay et al., 1993). A similar conclusion has been drawn elsewhere (Matthews and Wells, 1993). We hypothesize that phage that express unpaired or lone cysteines may be detrimental to phage propagation because the cysteines have the potential to form disulfide cross-bridges between cysteine residues on different peptides, proteins, and phage. Whenever possible, scientists should display proteins and protein domains that have an even number of cysteines. Recently, the eight cysteines of pIII have been demonstrated to be all in disulfide bridged; the cystine sites are Cys7-Cys36, Cys46-Cys53, Cys188-Cys201, and Cys354-Cys371 (Kremser and Rasched, 1994). Protein VIII on the other hand has no cysteines. At the moment, there are no data on the effect of unpaired cysteines in sequences displayed by pVIII. When phage display random peptides with even numbers of cysteines, the distance between the cysteines tends to be short. In a population of 228 phage displaying random peptides 38 residues in length there were 75 peptides with two cysteines, with the distance between cysteines of 0 to 21 residues. For the majority of inserts, however, the number of intervening residues was 4-6. This arrangement is nonrandom, because if the pairs of cysteines were positioned at random in a peptide of 38 residues, the mean interval would be 12 residues. The X2 value for the null hypothesis is 71.3, which is highly significant (p<0.0001; C. E. Smith, personal communication). The short interval among the phage-displayed peptides is most likely due to an increasing negative selection of phage for intervening distances greater or less than 5 residues; this may be due to inefficient disulfide bond formation. We should point out, however, that we have isolated some phage that display peptides that carry single cysteine residues. These phage are stable and grow quite well; curiously, the unpaired cysteines appear to be tolerated in these peptides. Presumably, these lone cysteines are buried in an inaccessible region of random peptides which fold up on themselves. In the course of our experiments, we have also observed biological selection against certain recombinants that is not based on cysteine frequency. Andrew Sparks, in one of our laboratories (B.K.K.), has attempted to clone oligonucleotides encoding the peptide sequence RRLIEDAEYAARG into gene III of M13. The recombinants formed tiny plaques (only visible in the presence of XGal and IPTG because the vector carrying lacZ formed blue plaques). When the phage in the small plaques were propagated in bacterial cultures for 6 hr, they yielded both large and small plaques. When both types of plaques were repropagated, all the large plaqueforming phage were stable and had deletions of the insert, whereas the tiny plaques continuously generated large plaques. The DNA in small plaques was verified to

52

Norris Armstrong et

al.

carry the desired insert by PCR; however, we were never able to isolate an adequate amount of DNA to confirm this by sequencing. Thus, certain peptide (and protein) sequences can be problematic in phage display experiments. Whenever one finds it difficult to generate recombinant phage that carry the insert of interest, there are a number of possible problems. Some of these defects will be a reflection of the sequence character of the displayed protein or peptide. Charged peptides may not pass through the inner bacterial membrane efficiently, for example, during assembly of pill into viral particles. However, this may be compensated for through the use of bacterial hosts that carry mutations in the secretory system (Peters et al., 1994) or are deficient in certain proteases (McLafferty et al., 1993). Several different hosts can be tested to identify the ideal genetic background which permits proper expression of the displayed element of interest. Another avenue to overcome cloning limitations observed during display of large foreign peptides or protein domains is to use phagemid, 33, or 88 vectors. There are many options available to investigators. References Barbas, C., Kang, A., Lerner, R., and Benkovic, S. (1991). Assembly of combinatorial antibody libraries on phage surfaces: The gene III site. Proc. Natl. Acad. Sci. U.S.A. 88, 7978-7982. Bass, S. H., Greene, R., and Wells, J. A. (1990). Hormone phage: An enrichment method for variant proteins with altered binding properties. Proteins 8, 309-314. Corey, D. R., Shiau, A. K., Yang, Q., Janowski, B. A., and Craik, C. S. (1993). Trypsin display on the surface of bacteriophage. Gene 128, 129-134. Cwirla, S. E., Peters, E. A., Barrett, R. W., and Dower, W. J. (1990). Peptides of phage: A vast library of peptides for identifying ligands. Proc. Natl. Acad. Sci. U.S.A. 87, 6378-6382. DeGraaf, M. E., Miceli, R. M., Mott, J. E., and Fischer, H. D. (1993). Biochemical diversity in a phage display library of random decapeptides. Gene 128, 13-17. Doorbar, J., and Winter, G. (1994). Isolation of a peptide antagonist to the thrombin receptor using phage display. J. Mol. Biol. 244, 361-369. Fowlkes, D., Adams, M., Fowler, V., and Kay, B. (1992). Multipurpose vectors for peptide expression on the M13 viral surface. BioTechniques 13, 422-427. Gram, H., Marconi, L. A., Barbas, C. E, Collet, T. A., Lerner, R. A., and Kang, A. S. (1992). In vitro selection and affinity maturation of antibodies from a naive combinatorial immunoglobulin library. Proc. Natl. Acad. Sci. U.S.A. 89, 3576-3580. Greenwood, J., Willis, A., and Perham, R. (1991). Multiple display of foreign peptides on a filamentous bacteriophage: Peptides from Plasmodium falciparum circumsporozoite protein as antigens. J. Mol. Biol. 220, 821-827. Haaparanta, T., and Huse, W. (1995). A combinatorial method for constructing libraries of long peptides displayed by filamentous phage. Mol. Div. 1, 39-52. Hogrefe, H. H., Amberg, J. R., Hay, B. N., Sorge, J. A., and Shopes, B. (1993). Cloning in a bacteriophage lambda vector for the display of binding proteins on filamentous phage. Gene 137, 85-91. Hoogenboom, H., Griffiths, A., Johnson, K., Chisswell, D., Hudson, P., and Winter, G. (1991). Multisubunit proteins on the surfaces of filamentous phage: Methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res. 19, 4133-4137. II'ichev, A. A., Minenkova, O. O., Tat'kov, S. I., Karpyshev, N. N., Eroshkin, A. M., Petrenko, V. A., and Sandakhchiev, L. S. (1989). Production of a viable variant of the M13 phage with a foreign peptide inserted into the basic coat protein. Dokl. Akad. Nauk. SSSR 307, 481-483. Kang, A. S., Barbas, C. E, Janda, K. D., Benkovic, S. J., and Lerner, R. A. (1991). Linkage of recognition and replication functions by assembling combinatorial antibody Fab libraries along phage surfaces. Proc. Natl. Acad. Sci. U.S.A. 88, 4363-4366.

Chapter 3 Vectorsfor PhageDisplay

53

Kasahara, N., Dozy, A. M., and Kan, Y. W. (1994). Tissue-specific targeting of retroviral vectors through ligand-receptor interactions. Science 266, 1373-1376. Kay, B. K., Adey, N. B., He, Y.-S., Manfredi, J. P., Mataragnon, A. H., and Fowlkes, D. M. (1993). An M13 library displaying 38-amino-acid peptides as a source of novel sequences with affinity to selected targets. Gene 128, 59-65. Kishchenko, G., Batliwala, H., and Makowski, L. (1994). Structure of a foreign peptide displayed on the surface of bacteriophage M13. J. Mol. Biol. 241,208-213. Kozlovska, T. M., Cielens, I., Dreilinna, D., Dislers, A., Baumanis, V., Ose, V., and Pumpens, P. (1993). Recombinant RNA phage Qb capsid particles synthesized and self-assembled in Escherichia coli. Gene 137, 133-137. Kremser, A., and Rasched, I. (1994). The adsorption of filamentous phage fd: Assignment of its disulfide bridges and identification of the domain incorporated in the coat. Biochemistry 33, 13954-13958. Lowman, H. B., and Wells, J. A. (1993). Affinity maturation of human growth hormone by monovalent phage display. J. Mol. Biol. 234, 564-578. Lowman, H. B., Bass, S. H., Simpson, N., and Wells, J. A. (1991). Selecting high-affinity binding proteins by monovalent phage display. Biochemistry 30, 10832-10838. Maruyama, I. N., Maruyama, H., and Brenner, S. (1994). hfoo: A h phage vector for the expression of foreign proteins. Proc. Natl. Acad. Sci. U.S.A. 91, 8273-8277. Matthews, D. J., and Wells, J. A. (1993). Substrate phage: Selection of protease substrates by monovalent phage display. Science 260, 1113-1117. McCafferty, J., Griffiths, A. D., Winter, G., and Chiswell, D. J. (1990). Phage antibodies: Filamentous phage displaying antibody variable domains. Nature (London) 348, 552-554. McConnell, S. J., Kendell, M. L., Reilly, T. M., and Hoess, R. H. (1994). Constrained libraries as a tool for finding mimotopes. Gene 151, 115-118. McLafferty, M. A., Kent, R. B., Ladner, R. C., and Markland, W. (1993). M 13 bacteriophage displaying disulfide-constrained microproteins. Gene 128, 29-36. Peters, E. A., Schatz, P. J., Johnson, S. S., and Dower, W. J. (1994). Membrane insertion defects caused by positive charges in the early mature region of protein plII of filamentous phage fd can be corrected by prlA suppressors. J. Bacterio1176, 4296-4305. Rodriguez, P. I., and Carrasco, L. (1994). Improved factor Xa cleavage of fusion proteins containing maltose binding proteins. BioTechniques 18, 238. Schwind, P., Kramer, H., Kremser, A., Ramsberger, U., and Rasched, I. (1992). Subtilisin removes the surface layer of the phage fd coat. Eur. J. Biochem. 210, 431-436. Scott, J. K., and Smith, G. P. (1990). Searching for peptide ligands with an epitope library. Science 249, 386-390. Smith, G. P. (1993). Surface display and peptide libraries. Gene 128, 1-2. Sternberg, N., and Hoess, R. (1995). Display of peptides and proteins on the surface of bacteriophage lambda. Proc. Natl. Acad. Sci. U.S.A. 92, 1609-1613. Valsesia-Wittmann, S., Drynda, A., Deleage, G., Aumailley, M., Heard, J. M., Danos, O., Verdier, G., and Cosset, F. L. (1994). Modifications in the binding domain of avian retrovirus envelope protein to redirect the host range of retroviral vectors. J. Virol. 68, 4609-4619. Winter, G., and Milstein, C. (1991). Man-made antibodies. Nature (London) 349, 293-299.